Journal: Genome Biology

Article Title: Multiplexed capture of spatial configuration and temporal dynamics of locus-specific 3D chromatin by biotinylated dCas9

doi: 10.1186/s13059-020-01973-w

Figure Lengend Snippet: Multiplexed CAPTURE of locus-specific long-range DNA interactions. a Schematic of multiplexed analysis of locus-specific chromatin interactions by the redesigned CAPTURE2.0 system containing the C-terminal biotin-tagged dCas9 (dCas9-CBio) and sgRNA. Major steps of the CAPTURE-3C-seq method are shown. b Schematic of dCas9-mediated multiplexed capture of the human β-globin LCR. c Genome-wide analysis of dCas9 binding in cells expressing LCR-targeting sgRNAs (sgLCR) or non-targeting sgGal4. Data points for the sgRNA target regions are shown by arrowheads, and the predicted off-targets are shown as red dots. The x - and y -axes denote the log2 mean read counts and the log2 ratio of read counts in sgLCR and sgGal4 samples from N = 2 and 4 CAPTURE-ChIP-seq experiments, respectively. d Genome-wide differential gene expression analysis was performed using RNA-seq in K562 cells expressing dCas9-CBio with sgLCR or wild-type (WT) K562 cells. The β-like globin genes are indicated by colored data points. Pearson correlation coefficient ( R ) value is shown ( N = 2 RNA-seq experiments). e Browser view of LCR-mediated long-range interactions (chr11: 5,222,424-5,323,623; hg19) is shown. Contact profiles including the density map and interactions (or loops) for the dCas9-captured LCR or the resolved individual HS regions are shown. The statistical significance of interactions was determined by the Bayes factor (BF) and indicated by the color scale bars. DHS, ChIP-seq, RNA-seq, ChromHMM, CAPTURE-ChIP-seq (sgLCR), and ChIA-PET (CTCF and RNAPII) data are shown for comparison

Article Snippet: Human K562 cells were obtained from ATCC and cultured in an IMDM medium containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S).

Techniques: 3C-Seq, Genome Wide, Binding Assay, Expressing, ChIP-sequencing, Gene Expression, RNA Sequencing, ChIA Pet Assay, Comparison

Journal: Genome Biology

Article Title: Multiplexed capture of spatial configuration and temporal dynamics of locus-specific 3D chromatin by biotinylated dCas9

doi: 10.1186/s13059-020-01973-w

Figure Lengend Snippet: Multiplexed CAPTURE of erythroid super-enhancers. a Schematic of the multiplexed analysis of erythroid SEs. SEs were identified by ROSE using H3K27ac ChIP-seq signal in K562 cells. Schematic of sgRNA design is shown. Pie charts on the left show the distribution of the captured SEs and constituent enhancers at intragenic, intergenic, or both regions. Pie charts on the right show the numbers and percentages of captured SEs and constituent enhancers (green color). b Genome-wide analysis of dCas9 binding in cells expressing SE-targeting sgRNAs (sgSE) or non-targeting sgGal4. Data points for the sgRNA captured SEs are shown as green. The x - and y -axes denote the log2 mean read counts and the log2 ratio of read counts in sgSE and sgGal4 samples from N = 2 and 4 CAPTURE-ChIP-seq experiments, respectively. c Genome-wide differential gene expression analysis was performed using RNA-seq in K562 cells expressing dCas9-CBio with sgSE or WT K562 cells. Data points for SE target genes and other genes are shown as red and gray, respectively. Pearson correlation coefficient ( R ) value is shown ( N = 2 RNA-seq experiments). d Analysis of SE-mediated long-range interactions by categorizing all interactions into SEs to gene promoters (SE-P), SEs to gene bodies (SE-G), and SEs to other genomic regions (SE-O). Schematic of SE-mediated interactions is shown on the top. The interaction frequency was calculated by the normalized PETs per kilobase of captured DNA sequences. Boxes show the median of the data and quartiles, and whiskers extend to 1.5× of the interquartile range. P values were calculated by a two-sided Kolmogorov-Smirnov (K-S) test. e Pie chart shows the fractions of the captured SE-mediated interactions between SEs and gene targets. f A representative locus is shown for the single SE to single gene interactions (SE137). Contact profiles including the density map and interactions for the dCas9-captured SE region (red bar) are shown. The statistical significance of interactions was determined by the Bayes factor (BF) and indicated by the color scale bars. DHS, ChIP-seq, ChromHMM, ChIA-PET (CTCF and RNAPII), and in situ Hi-C data are shown for comparison. g A representative locus is shown for the single SE to multiple genes (SE43). h A representative locus is shown for the multiple SEs to multiple genes (SE41 and SE42)

Article Snippet: Human K562 cells were obtained from ATCC and cultured in an IMDM medium containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S).

Techniques: ChIP-sequencing, Genome Wide, Binding Assay, Expressing, Gene Expression, RNA Sequencing, ChIA Pet Assay, In Situ, Hi-C, Comparison

Journal: Genome Biology

Article Title: Multiplexed capture of spatial configuration and temporal dynamics of locus-specific 3D chromatin by biotinylated dCas9

doi: 10.1186/s13059-020-01973-w

Figure Lengend Snippet: Hierarchical organization of super-enhancers identified by multiplexed CAPTURE. a Schematic of the hierarchical structure of SEs based on constituent enhancer-mediated long-range chromatin interactions. b Identification of hierarchical SEs by the H-score computational metric. c A representative locus is shown for a hierarchical SE containing the hub enhancer. Contact profiles including the density map, interactions between enhancers, and all interactions for the dCas9-captured SE region (red bar) are shown. The identified hub and non-hub enhancers are depicted by green (hub) and red (non-hub) lines, respectively. d A representative locus is shown for a non-hierarchical SE without hub enhancer. e Chromatin landscapes at hub, non-hub enhancers, and non-hierarchical SEs in K562 cells. Spatial distribution of DHS, histone marks (H3K4me1 and H3K27ac), TFs (p300, GATA1, and TAL1), RNAPII, and chromatin structure factors (CTCF, SMC3, and RAD21) is shown in hub ( N = 42) and non-hub enhancers ( N = 260) and non-hierarchical SEs ( N = 117). P values were calculated using the two-sample Kolmogorov-Smirnov (K-S) test. *** P < 0.001, ** P < 0.01, * P < 0.05, n.s. not significant

Article Snippet: Human K562 cells were obtained from ATCC and cultured in an IMDM medium containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S).

Techniques:

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate C2C12 cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Transfection, Cell Culture, Staining, Immunostaining, Infection, Expressing, Quantitative RT-PCR, Western Blot

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 3. E2f4 Is a Direct Transcription Target of MyoD/Myf5 MPCs used below Were Isolated by FACS from 2-Month-Old Wild-Type Mice (A) Sorted cells were fixed after either 1 hr of plating (i.e., quiescent satellite cells or QSC) or 1 day of culturing (i.e., activated satellite cells or ASC) followed by immunostaining for E2F4 (green). (B) MPCs from three mice were separately infected with adenoviruses expressing indicated shRNAs; 36 h later, the E2f4 mRNA levels were measured by qRT-PCR. (C) MPCs were transfected with siRNAs as indicated. E2F4 protein levels were measured by western blotting. (D) Top: schematic of the E2f4 promoter. TSS, transcription start site; blue boxes, exons; black box, the E box. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with a MyoD antibody or an immunoglobulin G control. The fold enrichment of MyoD on the specific E box in the E2f4 promoter is shown. NS, non-specific site. (E and F) MPCs (E) and C2C12 myoblasts (F) were transfected with siRNAs as indicated; 24 hr post transfection, cells were cultured in the pro-adipogenic media for 4 days followed by oil red O staining. Data are presented as mean ± SD. **p < 0.01, ***p < 0.001. Scale bars, 30 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Immunostaining, Infection, Expressing, Quantitative RT-PCR, Transfection, Western Blot, Control, Cell Culture, Staining

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 4. Prdm16 Is a Direct Transcription Target of the E2F4/p107/p130 Repressive Complex (A) FACS-isolated MPCs in triplicate were transfected with siRNAs as indicated. Relative gene expression was measured by qRT-PCR 24 hr after transfection. (B) Top: schematic of the Prdm16 promoter. #1 and #2 indicate the predicted E2F4 binding sites (black boxes). Blue box, exons. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with specific antibodies as indicated. The fold enrichment of E2F4, p107, or p130 on two potential E2F4 binding sites in the Prdm16 promoter and a known E2F4 binding site in the PPARg promoter (control) is shown. (C–F) C2C12 cells in triplicate were co-transfected with various luciferase reporters, siRNAs, and/or cDNA expression vectors as indicated. Cells were harvested 24 hr after transfection and luciferase activities were measured. In (C) and (D), a luciferase reporter construct carrying a 1.5-kb mouse Prdm16 proximal promoter was used. In (E), two luciferase reporter constructs were used, each carrying a short fragment of the Prdm16 promoter with one of the two (i.e., #1, #2) potential E2F4 binding sites. In (F), two luciferase reporter constructs were used, one carrying three copies of the wild-type E2F4 binding site (CGCAGC) found in site #2 and the other three copies of the mutated E2F4 binding site (CTCCTC). In (A)–(F), Fold changes were calculated. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Transfection, Gene Expression, Quantitative RT-PCR, Binding Assay, Control, Luciferase, Expressing, Construct